Week 8 Human Variation & Race

Cold:

Some side effects of cold weather can put you at risk of a heart attack. “Cold weather acts as a vasoconstrictor, which means it narrows blood vessels” putting a person at risk of a heart attack. Some other severe things are hypothermia, a drop in the body’s core temperature which is less than 95*F.  (A normal body temperature is between 97.7- 99.5) There is mild, moderate and severe hypothermia. Under 95 F your body starts to shut down. First, the body will send signals to the brain and then it will try to heat up properly trying to save the vital organs. But once “homeostasis” is interrupted from its stable condition, the body is now in danger.

  

Short Term:

People will get shivers when they get cold.  A part of your brain called the “hypothalamus” gets cold.  Not too cold just a little cold.  Then a part of your brain makes your muscles shake.  Your muscles are moving even though you are not running around. Your muscles shaking creates a lot of heat.  you will not stop shivering until your insides get warm.

Facultative: For example, A person from Calfornia that is used to warm weather and their body has never been put through freezing temperature goes to Boston Massachusettes during winter, Their body had to adjust to the freezing cold.

Developmental Adaptation: People living in the Arctic maintain metabolic rates between 13 and 45 percent higher than people not living in the Artic This is an example of developmental adaptation.

Cultural: Are similar ways that will bring people together having the same interests, beliefs, and same clothing to stay warm.

4) Learning from each other from is huge. That is why we study history, to learn from the past, how to fix things that did not work in the past and try again in the present time and from good things that work.  Even though they work, can we improve on that to make it better?  I believe we can.  computers are constantly being improved to work faster and smarter for us.

5) I can not use race as a variation of human adaptations. We are all the same on the inside just different colors on the exterior.  We can use cultural identifications, and how humans adapt to certain climates and environmental situations.

week 7. language

Part 1

In this experiment it was very difficult just to have a simple dialogue. I sat in the presence of my partner unable to reciprocate feelings, emotions, or words. Personally I found this assignment difficult because although I was able to contribute very minimal to the conversation, that was not enough for me and I had to hold back my opinion several times in order to complete the assignment. My partner continued to talk about their day and ask me simple yes or no questions however the questions soon started to elevate in which I was not able to respond so my partner went back to the more simpler dialogue.

My partner was in control of the conversation due to my lack of communication. When I could not respond to a creation topic my partner would then go ahead and change the topic to one that was easier for me to engage in. In this experiment I believe one of the purposes is to exclude yourself and by not talking back you are forced to listen and just observe. My partner most definitely had the power in the conversation because I was unable to give my feedback.

I believe that the culture with the more well known language would have the upper hand. Due to their well known language they would be able to communicate more effectively. Whereas symbolic language I feel as if, its only known to very little groups so it would not be as effective as a more well known language. In today’s society English is a very well known language whereas sign language is not as popular. Of course it is used in today’s society but it is not as common as English.

Part 2

In this experiment I found it to be somewhat easier than the first one because even though I could not use vocal intonation I was still able to speak in a very mono toned way. My partner felt that I was not very involved int he conversation and that I did not really care enough to carry on a conversation. My partner was confused as to why I was so monotoned throughout the conversation especially on a controversial debate.

I feel as if signs in our daily conversations are huge because they add and evoke more emotion and add to the conversation. You can always tell the way someone is feeling bad off of their body language. For example I can tell my mom that “I do not have attitude” but she always seems to noticed because I am very expressive int he way I present myself, especially in dialogue.

 Being able to identify someones body language can come in handy for many different reasons. Being in a higher position at your job and being able to asses someone during an interview for example you can see how they present themselves, their confidence level, etc. Another reason is sensing danger. The ability to read body language can help when an individual feels uneasy about something by someones body language or just the type of situation that individual could be in.

In many cases some people are better at reading body languages than other people and for me, personally I could say that I have a good grasp on the whole concept of body language. In some cases I feel as if some individuals are more animated than other and give off a sense of being happier or more outgoing when in reality that person could just be unaware of their gestures or body language.

Week 5 Piltdown Hoax

In the early 1900's Darwin pulled off a hoax that would take years to discover the truth.
While digging in a southern town of Lewes, Piltdown.  Darwin claimed to have found a piece of a human skull.  Darwin invited a couple of men,  geologist Arthur Smith Woodward and Paleontologist  Pierre Tay.  The three men claimed to make some great finds at the gravel pit.
They were excited because they thought they discovered evidence that England had ancient human fossils like other countries and they suggested that maybe this would be the oldest fossil of all. One of Darwin's greatest supporter was Arthur Keith, who wanted to prove his personal theory  "humans developed big brains before they walked upright."  We now know that this is incorrect and that "bipedalism, " developed before the big brain.
The hoax was finally discovered in the 1950's. By this time they had much better dating methods and allowed more people to analyze the fossils found by Darwin and Co.  By measuring fluorine content of the fossils, scientists could roughly date 100,000 ya, which was considered rather young instead of 10 million ya.

Human fault would be that everyone in the (science world) would accept these finding as concrete evidence. They didn't have reason not trust these three professional men.  Darwin wanted to be famous and was eager to put out his information not thinking of the consequences which later on would be,  him making science look like a joke and disgrace.

Thanks to better testing methods, such as "The Fluorine Method"  Dr. Kenneth Oakley was able to test the fossils by absorbing the fluorine into the bones from water and soil where they originally  were found.  The fossils did not match. the jaw and skull gave a smell proving that the jaw was older than the skull.  This was done by drilling into the bones.  They also did a "Nitrogen test" Proving once again that they were completely two different fossils bones.

I believe humans and machinery are both flawed and they need to work hand in hand in order to get a full grasp on scientific theories.  I believe that they both compliment each other because machines can give out facts and humans can build off of that.

My life lesson would be to always trust your gut.  If you feel something is wrong then investigate it until you have proof of it being right or wrong.  Whether it be related to science, or your own life lessons. Do not just stop because someone "swears" it to be true.  (for example a lying significant other).

Analogy/Homology

Homologous Traits

The wrist bone of the human being is homologous with the structures of many other animals such as the dolphin.  

The dolphin and human are both mammals and have the same genome.

They both share humerus bone fragments, carpals, ulna.

Although, dolphins live in water and humans do not they share many of the same characteristics

that their ancestors have passed down.

The common ancestor appears to be a reptile.

Analogous

Two flying species that one would consider the same are in fact analogous.  

The butterfly and the bird. The butterfly is an insect (invertebrate) while birds are vertebras and are warm blooded.

both have wings, both can fly.

The butterfly's wing has a fixed shape and an ecto-skeleton and look more like a leaf.

whereas the bird has forelimbs composed of three limb bones..the humerus, ulna and radius.

Although they share the same similarities, they did not evolve from the same ancestor because we know that the bird's ancestor is a reptile, I am not sure where the butterfly evolved from.

Week 2 Codon Code MrNa/DNA

CATTACACACAAGGCTTGCAAGGGAACGTCTGAATCGT

Week 1 Historical Influences on Darwin:

1). Alfred Russel Wallace who was born in 1823 and 14 years younger than Darwin.

Independently reached the same conclusion about natural selection.

2)  In 1858 Wallace wrote a letter to Darwin writing in detail his ideas about evolution.  Darwin was surprised that someone else had the same ideas as he.  Wallace was not famous like Darwin was.  Wallace inspired Darwin to publish his book a lot earlier than anticipated.  It would be 10 years later that  Wallace would publish his book.  Wallace's believed he was the father of biogeography 

( the study of how species are distributed) of how plants and animals would come to be about and end up living in certain places.  However, Wallace did not make it big to due Darwin’s previous publish book.  https://youtu.be/WJpZLwMIgk4

3). " Wallace believed that natural selection could not explain human intelligence on its own, arguing that some sort of higher power must be involved".  Darwin did not agree.   Wallace ran into money issues and Darwin helped him get a government pension in recognition of his scientific contributions. Although Wallace never became famous.   https://youtu.be/WJpZLwMIgk4

4) Yes, Darwin was already in the process of establishing his own idea of natural selection.  However Wallace's influence led Darwin to publish his ideas before Wallace had the chance to.

5). Darwin at the time was very hesitant about stating his theory due to the fact that he did not want his family nor friends to perceive him as a  hypocritical man who went against his family's beliefs.

If I were stranded on a desert island.

If I were stranded on a desert island, the two items that I would choose:  a boat and a map so I can take myself off the island and a map to know where I am going.