Analogy/Homology

Homologous Traits

The wrist bone of the human being is homologous with the structures of many other animals such as the dolphin.  

The dolphin and human are both mammals and have the same genome.

They both share humerus bone fragments, carpals, ulna.

Although, dolphins live in water and humans do not they share many of the same characteristics

that their ancestors have passed down.

The common ancestor appears to be a reptile.

Analogous

Two flying species that one would consider the same are in fact analogous.  

The butterfly and the bird. The butterfly is an insect (invertebrate) while birds are vertebras and are warm blooded.

both have wings, both can fly.

The butterfly's wing has a fixed shape and an ecto-skeleton and look more like a leaf.

whereas the bird has forelimbs composed of three limb bones..the humerus, ulna and radius.

Although they share the same similarities, they did not evolve from the same ancestor because we know that the bird's ancestor is a reptile, I am not sure where the butterfly evolved from.

Week 2 Codon Code MrNa/DNA

CATTACACACAAGGCTTGCAAGGGAACGTCTGAATCGT

Week 1 Historical Influences on Darwin:

1). Alfred Russel Wallace who was born in 1823 and 14 years younger than Darwin.

Independently reached the same conclusion about natural selection.

2)  In 1858 Wallace wrote a letter to Darwin writing in detail his ideas about evolution.  Darwin was surprised that someone else had the same ideas as he.  Wallace was not famous like Darwin was.  Wallace inspired Darwin to publish his book a lot earlier than anticipated.  It would be 10 years later that  Wallace would publish his book.  Wallace's believed he was the father of biogeography 

( the study of how species are distributed) of how plants and animals would come to be about and end up living in certain places.  However, Wallace did not make it big to due Darwin’s previous publish book.  https://youtu.be/WJpZLwMIgk4

3). " Wallace believed that natural selection could not explain human intelligence on its own, arguing that some sort of higher power must be involved".  Darwin did not agree.   Wallace ran into money issues and Darwin helped him get a government pension in recognition of his scientific contributions. Although Wallace never became famous.   https://youtu.be/WJpZLwMIgk4

4) Yes, Darwin was already in the process of establishing his own idea of natural selection.  However Wallace's influence led Darwin to publish his ideas before Wallace had the chance to.

5). Darwin at the time was very hesitant about stating his theory due to the fact that he did not want his family nor friends to perceive him as a  hypocritical man who went against his family's beliefs.

If I were stranded on a desert island.

If I were stranded on a desert island, the two items that I would choose:  a boat and a map so I can take myself off the island and a map to know where I am going.